Query (optional)   in Class  

GrainGenes Sequence Report: BQ295201

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BQ295201
Contig
Ta.30803.1.S1_at
Ta.30803.1.S1_x_at
NSFT03P2_Contig18637
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC287036
NCBI UniGene
Ta.54141
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, strongly similar to NP_200875.1 60S ribosomal protein L12 (RPL12C) [Arabidopsis thaliana]'
Keyword
EST
Species
Triticum aestivum
Cultivar
Chinese Spring
Clone Library
Wheat unstressed root tip cDNA library
Tissue
Root tip at 1.0 to 1.5 mm stage
Developmental Stage
Four-day old seedling
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE2867_C11_E21ZS Wheat unstressed root tip cDNA library Triticum aestivum cDNA clone WHE2867_C11_E21, mRNA sequence.
Strain
lab_host E. coli SOLR
Clone
WHE2867_C11_E21
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions for four days. Root tips were excised and snap frozen (Ross and Gustafson) and total RNA was prepared at University of Missouri, Columbia. Poly(A) RNA was purified, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript SK(- )phagemids in the TJ Close lab (Chin and Close) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions for four days. Root tips were excised and snap frozen (Ross and Gustafson) and total RNA was prepared at University of Missouri, Columbia. Poly(A) RNA was purified, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript SK(-)phagemids in the TJ Close lab (Chin and Close) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
tcggcacgagtccccgcagccaatcctccccaacccaagctcgcagccat
gcctcccaagctcgacccgtcccagatcgtggaggtgtatgtccgcgtca
ccggcggggaggtcggcgctgcgtcgtccctggcccccaagatcggtccg
ctcggtctctccccaaagaagatcggagaagacatcgccaaggagacggc
caaggactggaagggcctccgcgtcaccgtcaagctcaccgtccagaatc
gccaggccaaggtgtccgtcgtcccctccgccgcagccctcgtcatcaag
gcgctcaaggagcccgagagggaccgcaagaaggtcaagaacatcaagca
cagcggcaacatcagcctcgacgacgtcatcgagatcgccaagatcatga
aggtccgctccatggccaaggagatggccggcaccgtcaaggagatcctc
ggcacctgcgtcagcgtcggctgcaccgttgacggcaaggaccccaagga
tctgcagacggagatcgacgacggcgaggtggagatccccgcttaagaag
gcttggctttgggcaggttgttatgtgaggctgctgaagtagtttctcct
atctagatgcttcctgatgcatttgagagaatggatgtgatatcttcact
tgttctactcttgctgaagaaganacttttgtcatgctttactggttcca
ttgtgagactattntttactggtttaatgagtaccttgcggaatcaatca
atgttattatggcagctagaata
BLAST
BLAST Search