Query (optional)   in Class  

GrainGenes Sequence Report: BQ462765

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BQ462765
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC177890
NCBI UniGene
Hv.18271
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'Plasma membrane intrinsic protein'
Keyword
EST
Species
Hordeum vulgare subsp. vulgare
Cultivar
barke
Clone Library
HI
Tissue
female inflorescences
Developmental Stage
female inflorescences (approx. 3 mm in size)
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
HI01O22T HI Hordeum vulgare subsp. vulgare cDNA clone HI01O22 5-PRIME, mRNA sequence.
Strain
lab_host XL10-Gold
vulgare
Clone
HI01O22
Probe
GBM1121
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Stein Nils; Molecular Markers Group, Department Genbank; Institute of Plant Genetics and Crop Plant Research (IPK); Corrensstr. 3, 06466, Gatersleben, Germany; Tel: 039482-5522; Fax: 039482-5595; Email: stein@ipk-gatersleben.de; Insert Length: 550 Std Error: 0.00; Plate: 1 row: O column: 22; Seq primer: T3.
Note: Vector: pBluescript SK+; Site_1: EcoRI (5'-end of cDNA); Site_2: XhoI (3'-end of cDNA); Due to a cloning artefact caused by the kit, in most cases the EcoRI site is NOT present, as well as the EcoRIadapter used for cloning. To excise the insert, restriction sites upstream EcoRI should be used (e.g. BamHI, SalI,PstI). NOTE: Also due to the cloning system used Blue/white selection for recombinats is not 100% reliable.
DNA
caccaccacccccatccatcagacaagagagagagagagcgtctgcagtc
tgcagcctgcagcagccatggccaaggaggtgagcgaggagccggagcac
gccgcgccggcgcgcaaggactactcggacccgccgccggcgccgctgtt
cgacatgggggagctccggatgtggtccttctaccgggcgctcatcgccg
agttcgtcgccacgctgctctttctctacatcaccgtcgccaccgtcatc
ggctacaaggtgcagtcggcggccgacccgtgcgccggcgtcggggtgct
cggcatcgcctgggccttcggcggcatgatcttcgacctagtctactgca
ccgccggcatctcgggcggacacatcaacccggccgtcaccttcggcctc
ctcctcgcgcgcaaggtgtcgctgctgcgcgccgtcatgtacatcgtggc
gcagcgcgccggcggcatcgtgggcgccggcatcgtgaagggcatcatga
aggacgcgtaccacgccaacggcggcggcgccaacatggtcgcctcgggc
BLAST
BLAST Search