Query (optional)   in Class  

GrainGenes Sequence Report: BQ464159

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BQ464159
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC177780
NCBI UniGene
Hv.18748
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'Transcribed locus, moderately similar to NP_001055671.1 Os05g0442400 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Species
Hordeum vulgare subsp. vulgare
Cultivar
barke
Clone Library
HF
Tissue
caryopsis
Developmental Stage
developing caryopsis, 16-25 DAF (days after flowering)
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
HF01I06T HF Hordeum vulgare subsp. vulgare cDNA clone HF01I06 5-PRIME, mRNA sequence.
Strain
lab_host XL10-Gold
vulgare
Clone
HF01I06
Probe
GBM1092
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Stein Nils; Molecular Markers Group, Department Genbank; Institute of Plant Genetics and Crop Plant Research (IPK); Corrensstr. 3, 06466, Gatersleben, Germany; Tel: 039482-5522; Fax: 039482-5595; Email: stein@ipk-gatersleben.de; Insert Length: 476 Std Error: 0.00; Plate: 1 row: I column: 6; Seq primer: T3.
Note: Vector: pBluescript SK+; Site_1: EcoRI (5'-end of cDNA); Site_2: XhoI (3'-end of cDNA); developing caryopsis , 16-25 DAF(days after flowing) Due to a cloning artefact caused by the kit, in most cases the EcoRI site is NOT present, as well as the EcoRIadapter used for cloning. To excise the insert, restriction sites upstream EcoRI should be used (e.g. BamHI, SalI,PstI). NOTE: Also due to the cloning system used Blue/white selection for recombinats is not 100% reliable.Average insert size is 940 bp
Note: Vector: pBluescript SK+; Site_1: EcoRI (5'-end of cDNA); Site_2: XhoI (3'-end of cDNA); developing caryopsis, 16-25 DAF(days after flowing) Due to a cloning artefact caused by the kit, in most cases the EcoRI site is NOT present, as well as the EcoRIadapter used for cloning. To excise the insert, restriction sites upstream EcoRI should be used (e.g. BamHI, SalI,PstI). NOTE: Also due to the cloning system used Blue/white selection for recombinats is not 100% reliable.Average insert size is 940 bp
DNA
cccagaagtacttcatccgccaggccaacgccgccagccgcggcgacagc
aagcgcaagagcatccacgacatcaccaacgcgtgatgcgccatccgtcg
tgggcaagaaatcaagaatccggtccggccagagccgccgcccgtcgtcg
ccgccgtctgctctctctctctctcggcggtccgtgcaaatgtaggggaa
aggcgtagctcggctggaacctgcgattcggaaccagtaatctagcagtc
gtatcgtatggtcgaataaatcgtgtcctctgtcgcgtgtgacatgttaa
ggaagaaacagagtcggtcagttccggaaagggttatagcaatccaccgc
atgggtttttactgctttccttgtttagtaaactggaccgggttgatgat
agtggcatggcttttcacagcccgttctcatcctatatactccagtacta
ctgtatatcaatcaaaaaatgttacc
BLAST
BLAST Search