Query (optional)   in Class  

GrainGenes Sequence Report: BQ471178

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BQ471178
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC193803
NCBI UniGene
Hv.21175
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'Transcribed locus, weakly similar to NP_001052006.1 Os04g0105100 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Species
Hordeum vulgare subsp. vulgare
Cultivar
barke
Clone Library
HV
Tissue
germinating seeds
Developmental Stage
germinating seeds (48-96 h)
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
HV01H01T HV Hordeum vulgare subsp. vulgare cDNA clone HV01H01 5-PRIME, mRNA sequence.
Strain
lab_host XL10-Gold
vulgare
Clone
HV01H01
Probe
GBM1187
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Stein Nils; Molecular Markers Group, Department Genbank; Institute of Plant Genetics and Crop Plant Research (IPK); Corrensstr. 3, 06466, Gatersleben, Germany; Tel: 039482-5522; Fax: 039482-5595; Email: stein@ipk-gatersleben.de; Insert Length: 454 Std Error: 0.00; Plate: 1 row: H column: 1; Seq primer: T3.
Note: Vector: pBluescript SK+; Site_1: EcoRI (5'-end of cDNA); Site_2: XhoI (3'-end of cDNA); Roots were grown for two days on filter paper at room temperature. Due to a cloning artefact caused by the kit, in most cases the EcoRI site is NOT present, as well as the EcoRIadapter used for cloning. To excise the insert, restriction sites upstream EcoRI should be used (e.g. BamHI, SalI,PstI). NOTE: Also due to the cloning system used Blue/white selection for recombinats is not 100% reliable.Average insert size is 1 kb
DNA
cggcacgaggcaagaacggtgccccggcgaagcccccggcgccgcagcgc
acgccgtccttcatgctcaggcagacggtgcggagcctcctgccgggagg
cggcagcttcaagtcgtcggtcagagggtacgaggcctccctctccaggc
tcttcagcgggaggatcgccaggacggcgtcgctcccggcggtggacgat
ggcgcgctctcggcctcggcgcacggcgccggtgacaaaacccagcagag
cgttcctgctgctgcagctgacaagacgggcatgcaccggtcgcagtccc
tcccgatgaacatgaagaagttgagctcggccaagagcatcaagaggatg
aactcgctcggcggcgtgtaccgggtcgtgccctccacgccgcgagcccc
cgccgccgccgccgcgacgagcaatgccgcgccggacatagtccccacag
aacc
BLAST
BLAST Search