Query (optional)   in Class  

GrainGenes Sequence Report: BQ606896

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BQ606896
Contig
Ta.30803.1.S1_at
Ta.30803.1.S1_x_at
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC287036
NCBI UniGene
Ta.54141
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, strongly similar to NP_200875.1 60S ribosomal protein L12 (RPL12C) [Arabidopsis thaliana]'
Keyword
EST
Species
Triticum aestivum
Cultivar
Wyuna
Clone Library
wheat EST endosperm library
Tissue
endosperm
Developmental Stage
developing endosperm tissue 8, 10 and 12 DPA (days post anthesis)
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
BRY_2772 wheat EST endosperm library Triticum aestivum cDNA 5', mRNA sequence.
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Lambrecht M; The Arabidopsis Information Resource; Carnegie Institution of Washington, Dept. of Plant Biology; 260 Panama Street, Stanford, CA 94305, USA; Tel: 1 650 325 1521 x 251; Fax: 1 650 325 3748; Email: rhee@acoma.stanford.edu.
DNA
cccaagctcgcagccatgcctcccaagctcgacccgtcccagatcgtgga
ggtgtatgtccgcgtcaccggcggggaggtcggcgctgcgtcgtccctgg
cccccaagatcggtccgctcggtctctccccaaagaagatcggagaagac
atcgccaaggagacggccaaggactggaagggcctccgcgtcaccgtcaa
gctcaccgtccagaatcgccaggccaaggtgtccgtcgtcccctccgccg
cagccctcgtcatcaaggcgctcaaggagcccgagagggaccgcaagaag
gtcaagaacatcaagcacaacggcaacatcagcctcgacgacgtcatcga
gatcgccaagatcatgaaggtccgctccatggccaaggagatggccggca
ccgtcaaggagatcctcggcacctgcgtcagcgtcggctgcaccgtcgac
ggcaaggaccccaaggatctgcagacggagatcgacgacggcgatgtgga
gatccncgct
BLAST
BLAST Search