Query (optional)   in Class  

GrainGenes Sequence Report: BQ663710

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BQ663710
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC184244
NCBI UniGene
Hv.2982
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'Transcribed locus, weakly similar to NP_001048081.1 Os02g0741400 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Species
Hordeum vulgare subsp. vulgare
Cultivar
barke
Clone Library
HU
Tissue
germinating seeds
Developmental Stage
germinating seeds, 16-48 h
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
HU03K21u HU Hordeum vulgare subsp. vulgare cDNA clone HU03K21 3-PRIME, mRNA sequence.
Strain
lab_host XL10-Gold
vulgare
Clone
HU03K21
Probe
baak16e08
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Stein Nils; Molecular Markers Group, Department Genbank; Institute of Plant Genetics and Crop Plant Research (IPK); Corrensstr. 3, 06466, Gatersleben, Germany; Tel: 039482-5522; Fax: 039482-5595; Email: stein@ipk-gatersleben.de; Insert Length: 546 Std Error: 0.00; Plate: 3 row: K column: 21; Seq primer: M13uni.
Note: Vector: pBluescript SK+; Site_1: EcoRI (5'-end of cDNA); Site_2: XhoI (3'-end of cDNA); germinating seeds, 16-48h. Due to a cloning artefact caused by the kit, in most cases the EcoRI site is NOT present, as well as the EcoRIadapter used for cloning. To excise the insert, restriction sites upstream EcoRI should be used (e.g. BamHI, SalI,PstI). NOTE: Also due to the cloning system used Blue/white selection for recombinats is not 100% reliable. Average insert size is 1.2 kb
DNA
aacataccaattgtaaacgggttgagttgggcagcatacgcctactcgac
gggctgcaagtcatgcaatgctttactcgggcaacaaagtagctcagtag
ttaatggcaaagagtagtctatgtagctggccaaaaagacacaactacga
gtttctagcaacgaggacttgaactctttctaactcactattactggcca
cctcgccgagaacgtccccgtagtggtccgcgcccaccagcatctcgaga
acgagccctggaaggctgggtggttgtccgtacaagtctggttggtctgc
ttgttctcaagttgattgttctacccacagtctctgctccagtactggga
ttctgttgttcagaagatgcaccagcatgggctgggtttgaaggggaagg
ttcacgtgcaggggatgcatctgtggttctgcttggtgatgcatcggctc
cgcctgattgtgctattacagggctttggtctggctccacctcagcacgt
tcagcggtaccatcaccttctacaatctcctctgacatatctgcat
BLAST
BLAST Search