Query (optional)   in Class  

GrainGenes Sequence Report: BQ665919

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BQ665919
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC169375
NCBI UniGene
Hv.5965
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'Transcribed locus, moderately similar to NP_001054441.1 Os05g0110600 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Species
Hordeum vulgare subsp. vulgare
Cultivar
barke
Clone Library
HZ
Tissue
pericarp
Developmental Stage
0-7 DAP (days after pollination)
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
HZ01J06u HZ Hordeum vulgare subsp. vulgare cDNA clone HZ01J06 3-PRIME, mRNA sequence.
Strain
lab_host XL10-Gold
vulgare
Clone
HZ01J06
Probe
BaAK12I12
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Stein Nils; Molecular Markers Group, Department Genbank; Institute of Plant Genetics and Crop Plant Research (IPK); Corrensstr. 3, 06466, Gatersleben, Germany; Tel: 039482-5522; Fax: 039482-5595; Email: stein@ipk-gatersleben.de; Insert Length: 550 Std Error: 0.00; Plate: 1 row: J column: 6; Seq primer: M13uni.
Note: Vector: pBluescript SK+; Site_1: EcoRI (5'-end of cDNA); Site_2: XhoI (3'-end of cDNA); pericarp 0-7 DAP(days after pollination). Due to a cloning artefact caused by the kit, in most cases the EcoRI site is NOT present, as well as the EcoRIadapter used for cloning. To excise the insert, restriction sites upstream EcoRI should be used (e.g. BamHI, SalI,PstI). NOTE: Also due to the cloning system used Blue/white selection for recombinats is not 100% reliable.Average insert size is 900 bp
DNA
gtcaaaaacgttcttattcaacagacgcaagataatgatgtgcaatagtt
acatggtaagcaatgttctagctcatgctgaattgacctacccatactca
taaaaaattacaccgggattcaggaacaacattactgcctgaaccgattc
gatacactgctgctgttctaaggctctttaataatctacagaggttctgg
tgaactcccttcaggccgacccgatccgaaggcggaagtcccatcatgtt
atgttcaacaaaggatcttctcatcaaaagtgagccagactgtatacaag
aatccatgaaagcaggaaaagggtgaaagacgcgaacatcccctcctgaa
gcagcgcgccgtggcctccaaactcttcctcatcgaccttcaatagttgc
gcatagtaccagtaaattatgccagaggaaatggccacgaacaggacgat
ccaggcggcgccgacgagcgggacggcgccccagaggaggccgcaggcga
gccccacggcctgccggatccagtgcaccgcgtccagcagctggtccttg
BLAST
BLAST Search