Query (optional)   in Class  

GrainGenes Sequence Report: BQ744279

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BQ744279
Contig
Ta.30803.1.S1_at
Ta.30803.1.S1_x_at
NSFT03P2_Contig18637
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC332262
NCBI UniGene
Ta.54141
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, strongly similar to NP_200875.1 60S ribosomal protein L12 (RPL12C) [Arabidopsis thaliana]'
Keyword
EST
Species
Triticum aestivum
Cultivar
Chinese Spring
Clone Library
Wheat salt-stressed root cDNA library
Tissue
Roots
Developmental Stage
Full tillering
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE4113_G04_M07ZS Wheat salt-stressed root cDNA library Triticum aestivum cDNA clone WHE4113_G04_M07, mRNA sequence.
Strain
lab_host E. coli SOLR
Clone
WHE4113_G04_M07
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK(-); Site_1: EcoRI; Site_2: XhoI; Hydroponic plants grown to full tillering stage were treated with 150 mM NaCl for either 12 hours or 7 days. Root tissues of the plants subjected to both types of treatment were collected separately at University of California, Davis (E. Akhunov and K. Deal in J. Dvorak's Lab). Total RNA was prepared separately from the two samples (12h and 7day treatments), and equal amount of RNA was then pooled. PolyA RNA was purified from the pooled RNA, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript SK(-) phagemids in J. Dvorak's lab (E. Akhunov, J. Dvorak) at the University of California, Davis. Colony plating, plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
gaggcccacagccaatcctccccagcccaagctcgcagccatgcctccca
agctcgacccgtcccagatcgtggaggtgtatgtccgcgtcaccggcggg
gaggtcggcgctgcgtcgtccctggcccccaagatcggcccgctcggtct
ctccccaaagaagatcggagaagacatcgccaaggagacggccaaggact
ggaagggcctccgcgtcaccgtcaagctcaccgtgcagaatcgccaggcc
aaggtgtccgtcgtcccctccgccgcagccctcgtcatcaaggcgctcaa
ggagcccgagagggaccgcaagaaggtcaagaacatcaagcacagcggca
acatcagcctcgacgacgtcatcgagatcgccaagatcatgaaggtccgc
tccatggccaaggagatggccggcaccgtcaaggagatccttggcacctg
cgtcagcgtcggctgcaccgtcgacggcaaggaccccaaggatctgcaga
cggagatcgacgacggcgaggtggagatccccgcttaagaaggcttggct
ttgggcaggttgttatgtgaggctgctgaagtagtttctcctatctagat
gcttcctgatgcagttgagagaatggatgtgatatcttcacttgttctac
tcgtgctgaagaagaaacttttgtcatgctttag
BLAST
BLAST Search