Query (optional)   in Class  

GrainGenes Sequence Report: BQ803215

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BQ803215
Contig
Ta.30803.1.S1_at
Ta.30803.1.S1_x_at
NSFT03P2_Contig18637
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum monococcum
Keyword
EST
Species
Triticum monococcum
Cultivar
G3116
Clone Library
Triticum monococcum vernalized apex cDNA library
Tissue
Vernalized apex
Developmental Stage
One month old plants
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE2835_A10_B19ZS Triticum monococcum vernalized apex cDNA library Triticum monococcum cDNA clone WHE2835_A10_B19, mRNA sequence.
Strain
lab_host E. coli XLOLR
Clone
WHE2835_A10_B19
Remark
DB_xref: taxon:4568
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; One-month old plants were subjected to vernalization treatment by placing them in the cold room at 6 C, under 15hr light/9hr dark condition. Total RNA was prepared from apex tissue extracted from plants with no cold treatment; and from plants with 2-week , 4-week and 6-week cold treatment separately. Equal amount of total RNA was pooled from all four samples, a cDNA library was made using pooled polyA RNA and cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova, J. Dubcovsky ). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; One-month old plants were subjected to vernalization treatment by placing them in the cold room at 6 C, under 15hr light/9hr dark condition. Total RNA was prepared from apex tissue extracted from plants with no cold treatment; and from plants with 2-week, 4-week and 6-week cold treatment separately. Equal amount of total RNA was pooled from all four samples, a cDNA library was made using pooled polyA RNA and cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova, J. Dubcovsky). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
tcggcacgaggcccacagccaatcctccccagcccaagctcgcagccatg
cctcccaagctcgacccgtcccagatcgtggaggtgtatgtccgcgtcac
aggcggggaggtcggcgctgcgtcgtccctggcccccaagatcggtccgc
tcggtctctccccaaagaagatcggagaagacatcgccaaggagacggcc
aaggactggaagggcctccgcgtcaccgtcaagctcaccgtccagaatcg
ccaggccaaggtgtccgtcgtcccctccgccgcagccctcgtcatcaagg
cgctcaaggagcccgagagggaccgcaagaaggtcaagaacatcaagcac
aacggcaacatcagcctcgacgacgtcatcgagatcgccaagatcatgaa
ggtccgctccatggccaaggagatggccggcaccgtcaaggagatcctcg
gcacctgcgtcagcgtcggctgcaccgtcgacggcaaggaccccaaggat
ctgcagacggagatcgacgacggcgaggtggagatccccgcttaagaagg
cttggctttggggaggttgttgtgtgaggctgctgaagtagtttctccta
tctagatgcttcctgatgcagttgagagaatggatgtgatgtcttcactt
gttctactcttgctgaagaagagacttttgtcatgctttagtggttccat
tgtgagactatttttttactgctttaatgagtaccttgtggaatcaatca
atgttattatggcagctagaatat
BLAST
BLAST Search