Query (optional)   in Class  

GrainGenes Sequence Report: BS00010734_51

[Submit comment/correction]

Sequence
BS00010734_51
Contig
2BS_5227366
Probe
BS00010734_51
DNA Homology
2BS_5227366Best IWGSC match1712e-40URGI_BestIWGSC_N
BLAST, e-value
2e-402BS_5227366Best IWGSC match
DNA
agcactggcgcgccattcgtcacaacctcacatcagaggtcctccaccca
Rcgcagctccaccggcacgcgtcagcgcgccgccgtgcactacatggact
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.