Query (optional)   in Class  

GrainGenes Sequence Report: BS00010796_51

[Submit comment/correction]

Sequence
BS00010796_51
Contig
7DS_3922210
Probe
BS00010796_51
DNA Homology
7DS_3922210Best IWGSC match1567e-36URGI_BestIWGSC_N
BLAST, e-value
7e-367DS_3922210Best IWGSC match
DNA
cgaaccgaccgcaatccttaaggtcttgagcctcaggggttgaggtcctt
Racgatgaagttctggcggctgatggggttcatgatgaccggcggcccag
c
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.