Query (optional)   in Class  

GrainGenes Sequence Report: BS00011608_51

[Submit comment/correction]

Sequence
BS00011608_51
Contig
5AL_2772383
Species
Triticum aestivum
Probe
BS00011608_51
DNA
agtggcccttttgtccattcctagcatgatgcaacattcggcgagcagat
Rgccgtctgcaagtctgaccatgagtgtatcattgtttggatcaatggag
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.