Query (optional)   in Class  

GrainGenes Sequence Report: BS00011810_51

[Submit comment/correction]

Sequence
BS00011810_51
Contig
1BS_3478312
Probe
BS00011810_51
DNA Homology
1BS_3478312Best IWGSC match1343e-29URGI_BestIWGSC_N
BLAST, e-value
3e-291BS_3478312Best IWGSC match
DNA
tttccagggatagggttgctgtagcttgagtctggtgatgatgggacttc
Raatccaacaacttgcaccccttcatggtcatccctgccttgtcggtggt
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.