Query (optional)   in Class  

GrainGenes Sequence Report: BS00011892_51

Sequence
BS00011892_51
Contig
1AL_2580763
Probe
BS00011892_51
DNA Homology
1AL_2580763Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441AL_2580763Best IWGSC match
DNA
ccaaacatttcaagaccatcgatagatcctggaggctgcagtgtaggaac
Rttaggccttcccatactgagttgcctccgtatttccatgttcagcctct
c
BLAST
BLAST Search