Query (optional)   in Class  

GrainGenes Sequence Report: BS00011962_51

[Submit comment/correction]

Sequence
BS00011962_51
Contig
6AL_5834888
Probe
BS00011962_51
DNA Homology
6AL_5834888Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-426AL_5834888Best IWGSC match
DNA
ttcacatggaaataaaaagtcctaaaagttggtgcggcgaatgaaaaaga
Raaaaaggagcgatcgacaccctatgcggcgacaggtagcaggccgttgt
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.