Query (optional)   in Class  

GrainGenes Sequence Report: BS00012230_51

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BS00012230_51
Contig
2DL_9894863
Species
Triticum aestivum
Probe
BS00012230_51
DNA
cagggatttcttgtaggttcttatggtctgacatgggcattgaagaactc
Raacaaacttcttaaggtagcaatccttaacagcccacttactgtttctt
c
BLAST
BLAST Search