Query (optional)   in Class  

GrainGenes Sequence Report: BS00020869_51

[Submit comment/correction]

Sequence
BS00020869_51
Contig
2BL_8005433
2DL_9878493
Species
Triticum aestivum
Probe
BS00020869_51
DNA Homology
2BL_8005433Best IWGSC match1134e-23URGI_BestIWGSC_N
BLAST, e-value
4e-232BL_8005433Best IWGSC match
DNA
aggacgcatccgagaacgccgaatatgtgcagcttctcacgcagcattac
Rtgtgcaagtacagcactgatgattatgctgagagcaccaaggggagtaa
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.