Query (optional)   in Class  

GrainGenes Sequence Report: BS00022116_51

[Submit comment/correction]

Sequence
BS00022116_51
Contig
5DS_2774857
Probe
BS00022116_51
DNA Homology
5DS_2774857Best IWGSC match1673e-39URGI_BestIWGSC_N
BLAST, e-value
3e-395DS_2774857Best IWGSC match
DNA
agggcggcccgtgcggcagcgccgcgggtaggggtgctccttgccaccca
Rcacgggccgtgtggtggggttcttttcgtcgtcggggttgccgaggtca
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.