Query (optional)   in Class  

GrainGenes Sequence Report: BS00022443_51

[Submit comment/correction]

Sequence
BS00022443_51
Contig
1AS_3269971
Probe
BS00022443_51
DNA Homology
1AS_3269971Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441AS_3269971Best IWGSC match
DNA
aatttacttcacatcaacaccgcaacctcgctactcatctttcatagtcc
Mcaccctcactactcctctctcaaagcattggatctgttgctgctgctgc
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.