Query (optional)   in Class  

GrainGenes Sequence Report: BS00025560_51

[ Submit comment/correction ]

Sequence
BS00025560_51
Contig
6AS_4427440
Probe
BS00025560_51
DNA Homology
6AS_4427440Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446AS_4427440Best IWGSC match
DNA
tacataacatcaccaagcgacagcctgctgaaaatgatgagcgggcaagc
Rcacgaaacatagggcaaacaaagcaatacgaaacgcctaacgcacgttc
t
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.