Query (optional)   in Class  

GrainGenes Sequence Report: BS00026456_51

[Submit comment/correction]

Sequence
BS00026456_51
Contig
1AS_3314674
Probe
BS00026456_51
DNA Homology
1AS_3314674Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441AS_3314674Best IWGSC match
DNA
agcttaattgtagttctgatccattaatttattcacatttgcattccttc
Rttcatttgtaaattgtacacacctgtaaattggctaggctgtgttcata
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.