Query (optional)   in Class  

GrainGenes Sequence Report: BS00027799_51

[Submit comment/correction]

Sequence
BS00027799_51
Contig
2AL_6365472
Probe
BS00027799_51
DNA Homology
2AL_6365472Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442AL_6365472Best IWGSC match
DNA
tttgagaaaaattcaatgtcaaagctcgagaaactccaggtgaggtttct
Rcacagagaatctaagatagtcgaaggcatggagcatttgacaagcctta
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.