Query (optional)   in Class  

GrainGenes Sequence Report: BS00035273_51

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BS00035273_51
Contig
1AL_2395795
Probe
BS00035273_51
DNA Homology
1AL_2395795Best IWGSC match1727.00005e-41URGI_BestIWGSC_N
BLAST, e-value
7.00005e-411AL_2395795Best IWGSC match
DNA
cgagccccatctgaggtgatgagcgcgttgttagggccagcctctgagtt
Rgctctagcccagtcatacgacttgaggtgcatggagccgaagagcatct
t
BLAST
BLAST Search