Query (optional)   in Class  

GrainGenes Sequence Report: BS00039187_51

[Submit comment/correction]

Sequence
BS00039187_51
Contig
2BL_8003470
Probe
BS00039187_51
DNA Homology
2BL_8003470Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442BL_8003470Best IWGSC match
DNA
atagaaaggctttggatatccttgatgtgtgtgacagacagggcattcag
Raaaacgagtaaaaaacttaaaataggggaaatatgtatcgatgcatgca
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.