Query (optional)   in Class  

GrainGenes Sequence Report: BS00040165_51

[Submit comment/correction]

Sequence
BS00040165_51
Probe
BS00040165_51
DNA
gtgcagagcggaataaacaacatcgagcacgagacagtattatgacccaa
Rataaattattccagagttaataataatggagtagacattcacaggcgcg
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.