Query (optional)   in Class  

GrainGenes Sequence Report: BS00040380_51

[Submit comment/correction]

Sequence
BS00040380_51
Contig
6BL_4256071
Species
Triticum aestivum
Probe
BS00040380_51
DNA
attacttggttgttcagctaaccacacaccatgcacgattaatagtacgt
Rgtataatatacatcacacagctaaagcaacgtacatggccacattctta
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.