Query (optional)   in Class  

GrainGenes Sequence Report: BS00041587_51

[Submit comment/correction]

Sequence
BS00041587_51
Contig
2BS_5204122
Probe
BS00041587_51
DNA Homology
2BS_5204122Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442BS_5204122Best IWGSC match
DNA
gataattcttgtgcctagtgtggtgcttctgaagataagctcaggcagag
Ratgagactgcccagccttgaatgattgcgttgatgtgattagtgatcag
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.