Query (optional)   in Class  

GrainGenes Sequence Report: BS00047085_51

[Submit comment/correction]

Sequence
BS00047085_51
Contig
6AS_4373090
Species
Triticum aestivum
Probe
BS00047085_51
DNA
ctcgtctctattttttctcttttgtgagagctccctgatctcatctcact
Rggcagtaacttgtatgagcactgccatgggtttagtgcaacattcagag
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.