Query (optional)   in Class  

GrainGenes Sequence Report: BS00064298_51

[Submit comment/correction]

Sequence
BS00064298_51
Contig
5BS_1629420
Probe
BS00064298_51
DNA Homology
5BS_1629420Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445BS_1629420Best IWGSC match
DNA
gagcaagcaagccaagggacaagatgcaacactaattgtcaacgcggttc
Rgaccctctccaactacatgatgttcctcctagtggcacgcccctatatg
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.