Query (optional)   in Class  

GrainGenes Sequence Report: BS00065136_51

[Submit comment/correction]

Sequence
BS00065136_51
Contig
2BL_8081476
Probe
BS00065136_51
DNA Homology
2BL_8081476Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-422BL_8081476Best IWGSC match
DNA
tttctcacccaatccttggtgttgtaataacagtaaccaaataagcatgg
Rcagaacttgcagaagatcacccattggtattggacacaaaccagctcgc
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.