Query (optional)   in Class  

GrainGenes Sequence Report: BS00065250_51

[Submit comment/correction]

Sequence
BS00065250_51
Contig
7AL_4373898
Probe
BS00065250_51
DNA Homology
7AL_4373898Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-447AL_4373898Best IWGSC match
DNA
gctgctactgtaacatccacaggtttccacctgtttgtgaaaagtgctgc
Ragtaatatcaagtctgtaaaaccgtatcaggatgtgtcttcactttgcc
c
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.