Query (optional)   in Class  

GrainGenes Sequence Report: BS00066971_51

[ Submit comment/correction ]

Sequence
BS00066971_51
Contig
1BS_3437137
Probe
BS00066971_51
DNA Homology
1BS_3437137Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441BS_3437137Best IWGSC match
DNA
gcacaagttgatcaaatctagcaggaactccaatccgttggccttcatgg
Rctcgtcgccggtagaatcagccgcgccgtttcaaatcaaactcccggcg
a
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.