Query (optional)   in Class  

GrainGenes Sequence Report: BS00067119_51

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BS00067119_51
Contig
1AL_3971867
Probe
BS00067119_51
DNA Homology
1AL_3971867Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441AL_3971867Best IWGSC match
DNA
atggacgaaggaaatcaaagggtatggttgccgagaggaggaaagcaagc
Rgagtatatttgcttctgttatgaacttgtggtatcgtgctcggcatata
c
BLAST
BLAST Search