Query (optional)   in Class  

GrainGenes Sequence Report: BS00067129_51

[Submit comment/correction]

Sequence
BS00067129_51
Contig
5DS_2744407
Probe
BS00067129_51
DNA Homology
5DS_2744407Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445DS_2744407Best IWGSC match
DNA
ggaacgatcccatcaggtcgaacagcaagaggaacgatttcatcaggctg
Racggcgagcagcatccatgcctgacgcacacggcatcgtgcctgccgag
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.