Query (optional)   in Class  

GrainGenes Sequence Report: BS00068094_51

[Submit comment/correction]

Sequence
BS00068094_51
Contig
3AL_4290802
Probe
BS00068094_51
DNA Homology
3AL_4290802Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-443AL_4290802Best IWGSC match
DNA
gcagttgtgggaactgcaaacgaatgaaaaggcggcgaatgtaagcagac
Rtgcataagttggcattggaaagatgaagtggaggaaagaaaggcagcac
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.