Query (optional)   in Class  

GrainGenes Sequence Report: BS00073084_51

[Submit comment/correction]

Sequence
BS00073084_51
Contig
7BL_6723646
Probe
BS00073084_51
DNA Homology
7BL_6723646Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-447BL_6723646Best IWGSC match
DNA
caaaactgatttctcggtggattggaatatcaagtcattagatccaagtc
Rtcgttcctgtgcttgctagccggtactaatatgcagaccaagcatatac
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.