Query (optional)   in Class  

GrainGenes Sequence Report: BS00076693_51

[Submit comment/correction]

Sequence
BS00076693_51
Contig
2AS_5242393
Probe
BS00076693_51
DNA Homology
2AS_5242393Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442AS_5242393Best IWGSC match
DNA
ggctaggttaacgccgccagcttcctccctccacgctgaatccactacgc
Ratgttgtcggctgttcaaacttgtcctccgccgctcttgatcgacgacc
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.