Query (optional)   in Class  

GrainGenes Sequence Report: BS00077633_51

[ Submit comment/correction ]

Sequence
BS00077633_51
Contig
4AS_5960827
Species
Triticum aestivum
Probe
BS00077633_51
DNA
ggctagctttattaaaattaaacaatgtttacatcgtctatgagcttacg
Racaacacaaacacagtcaaaaggctcatccaaccaactgaaaaaagatt
t
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.