Query (optional)   in Class  

GrainGenes Sequence Report: BS00077855_51

[Submit comment/correction]

Sequence
BS00077855_51
Contig
5AL_1602962
Probe
BS00077855_51
DNA Homology
5AL_1602962Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445AL_1602962Best IWGSC match
DNA
gacaataacaattttctctgcttggcagagtggatgcttggaatcatcaa
Rcctgccctgatgcaatgcagccagatatttttctctggttggcacaatg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.