Query (optional)   in Class  

GrainGenes Sequence Report: BS00078085_51

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BS00078085_51
Contig
1AL_3905288
Probe
BS00078085_51
DNA Homology
1AL_3905288Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441AL_3905288Best IWGSC match
DNA
taatttttaacttaaactatgagtacatctcataattccttaagcgatgt
Ragcagacatacaaacctacaaagtgagacaattgcccctttcagacacc
a
BLAST
BLAST Search