Query (optional)   in Class  

GrainGenes Sequence Report: BS00082412_51

[Submit comment/correction]

Sequence
BS00082412_51
Contig
1DL_2199320
Probe
BS00082412_51
DNA Homology
1DL_2199320Best IWGSC match1372e-30URGI_BestIWGSC_N
BLAST, e-value
2e-301DL_2199320Best IWGSC match
DNA
gacttcgccttgggcacaacccttgtggtaacagatgcccgaagagaccc
Rgtcttgcccaggaacgaggatcccaattcgaagttaattgatgaggacg
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.