Query (optional)   in Class  

GrainGenes Sequence Report: BS00086533_51

[Submit comment/correction]

Sequence
BS00086533_51
Contig
2BL_8005433
Species
Triticum aestivum
Probe
BS00086533_51
DNA
cggccacataacacatgaaggctggttcagtggccagatcccaaacttct
Rtcaccgactcaatttgacgctcttgcggggcatggaggacaatggtggt
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.