Query (optional)   in Class  

GrainGenes Sequence Report: BS00093403_51

[Submit comment/correction]

Sequence
BS00093403_51
Contig
2BL_8028263
Probe
BS00093403_51
DNA Homology
2BL_8028263Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442BL_8028263Best IWGSC match
DNA
agtatgtttccacttctatcaacagtacgctgatcattgtggttattagc
Raagagcctggtgtgatgacgcttctggacgactacaaaagtaactggag
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.