Query (optional)   in Class  

GrainGenes Sequence Report: BS00106641_51

[Submit comment/correction]

Sequence
BS00106641_51
Contig
1AL_3900403
Probe
BS00106641_51
DNA Homology
1AL_3900403Best IWGSC match1727.00005e-41URGI_BestIWGSC_N
BLAST, e-value
7.00005e-411AL_3900403Best IWGSC match
DNA
tttgtagttgcagtcagtgtcagcgagttttggcgtgtgcttgaggtggg
Rtgtttgtacttacatgccatatttctccgttgtggtctggaggagagaa
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.