Query (optional)   in Class  

GrainGenes Sequence Report: BS00108058_51

[Submit comment/correction]

Sequence
BS00108058_51
Contig
1BS_3397538
Species
Triticum aestivum
Probe
BS00108058_51
DNA
acaaacagaacaggggctggtgaggcaaacgagagcacgaatttttgcac
Rggagcgccttgccacggctgttcttcagtaaatctcaacaaaaagatgg
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.