Query (optional)   in Class  

GrainGenes Sequence Report: BU100661

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BU100661
Contig
Ta.10114.1.S1_at
Ta.10114.2.S1_a_at
NSFT03P2_Contig13509
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC291281
NCBI UniGene
Ta.55375
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, strongly similar to NP_001051710.1 Os03g0819100 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Species
Triticum aestivum
Cultivar
Chinese Spring
Clone Library
Chinese Spring aluminum-stressed root tip cDNA library
Tissue
Root tip at 1.0 to 1.5 mm stage
Developmental Stage
Seedling
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE3356_A12_A24ZS Chinese Spring aluminum-stressed root tip cDNA library Triticum aestivum cDNA clone WHE3356_A12_A24, mRNA sequence.
Strain
lab_host E. coli SOLR
Clone
WHE3356_A12_A24
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown for four days under hydroponic conditions with 1ppm aluminum, root tips were excised and snap frozen, and total RNA was prepared at University of Missouri in the JP Gustafson lab (Ross). Poly(A) RNA was purified, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript SK(-) phagemids in the TJ Close lab (Chin) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
gctcgcgcatagttggactggaaacctcatcaccaacaaaaccaacgagg
acttctggctaaatgagggtttcacaacatatgctgagaggaggattgtc
gaggtggttcaaggtgaggagcgggcggccttaaacagcggaattggatg
gagagggttgaacagaatgatggagaggtttaaggataacatggagttta
ccaaactgaagccgaagatggctgggattgatcctgatgatgtttactca
gaagtgccctatgagaaaggcttccagttcctttggcgcatcgaacgcca
gattggccgacctgcattcgatgaattcctcaagaagtatattgccaact
tcaagttccaatcgatagatacagagacatttcttgaattcctgagagcc
aatgtacctgggattgaaaatcaagttgaccttcatgagtggatcaatgg
tactggtctccctccggatgccatggagccagaatcagctacctataaga
agatttgtgtcttagctgcagagtttaagtctggaaaaattccaagtgaa
gaggaggtggcagactggagtggacaagaatgggagctttacttggaaaa
tttacccacagatgttgaagcatcacaggttactgctcttgatgaacggt
acaagctgtcagaaagccgcgactacgaggtcanagtcgcattcctccag
ctagcgatccccacgggctgcaggtgttacttcaacgaggtggagaaatg
cttg
BLAST
BLAST Search