Query (optional)   in Class  

GrainGenes Sequence Report: BV211826

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BV211826
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
STS
Species
Triticum aestivum
Clone Library
Wheat var Chinese Spring Genomic DNA
Data Source
genbankRelease 145, Dec 15 2004
Title
BARC182 Wheat var Chinese Spring Genomic DNA Triticum aestivum STS genomic, sequence tagged site.
Probe
BARC182
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'genomic DNA'
Locus Comment: Synonyms: XBARC182; Contact: Dr. Perry Cregan; Soybean Genomics Improvement Laboratory; United States Department of Agriculture; BARC-WEST, Bldg. 006, Rm 100, 10300 Baltimore Ave., MD 20705, USA; Tel: 301-504-5070; Fax: 301-504-5728; Email: creganp@ba.ars.usda.gov; Primer A: CCATGGCCAACAGCTCAAGGTCTC; Primer B: CGCAAAACCGCATCAGGGAAGCACCAAT; STS size: 105; PCR Profile:; Presoak: 95 degrees C for 3.0 minute(s); Denaturation: 95 degrees C for 45 second(s); Annealing: 58 degrees C for 45 second(s); Polymerization: 72 degrees C for 45 second(s); PCR Cycles: 35; Thermal Cycler: Perkin Elmer TC or MJ PTC-225 or MBS; Satellite 384; Protocol:; Template: 30-100 ng; Primer: each 1.5 uM; dNTPs: each 200 uM; Taq Polymerase: 0.05 units/ul; Total Vol: 10 ul; Buffer:; MgCl2: 2.5 mM; KCl: 50 mM; Tris-HCl: 10 mM; pH: 8.3.
Note: Vector: pBluescript; V-type: Plasmid; Genomic fragments cloned into pBluescript
EMBL Feature
primer_bind90113Location: 90..113
STS90335Location: 90..>335
DNA
ggaaaggaggttagaggactttttcttcttgggacgccgcatccatggag
ctccgaccccattgccactgccatacatggagctctggcccatggccaac
agctcaaggtctcgccccacctctcctctctctctctctctctctctctc
atttcaaattgctaggattggtgcttccctgatgcggtttttttttcatt
ccttggaagtgttttcctcgcacacgttggtgcgacacagagccaccgtg
gggattccttccactacgacgtctcctggtttctcctccggtgcccccat
tcttcttccacttcagcaagtggtgatccaccggt
BLAST
BLAST Search