Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c10343_320

[Submit comment/correction]

Sequence
BobWhite_c10343_320
Contig
6AL_5813813
Probe
BobWhite_c10343_320
DNA Homology
6AL_5813813Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-426AL_5813813Best IWGSC match
DNA
aagaagaaggtgaagacaaagctctcagcactgggaaaagccaaggccgc
Rcaagccatggagctcgacaactgactgattcccatggcctaaactgttg
c
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.