Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c10659_188

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c10659_188
Contig
4AS_6012028
Probe
BobWhite_c10659_188
DNA Homology
4AS_6012028Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-444AS_6012028Best IWGSC match
DNA
ttccttgaccgtggcgcctggatcgagcacggatccgacccccaatctgc
Rgcagctttcttctgcagcatcttgacgatccgatttctccggcagtctc
g
BLAST
BLAST Search