Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c13752_400

[Submit comment/correction]

Sequence
BobWhite_c13752_400
Contig
2AL_6384029
Probe
BobWhite_c13752_400
DNA Homology
2AL_6384029Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442AL_6384029Best IWGSC match
DNA
tgctgcggcgagcggctgctgttgatttcattcacgcacgctaatcccgg
Rcatctatctatgatctatctttatctttgtggaggatggatgaaaacgt
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.